NextSeq 500 sequencing; GSM3643592: single CD103- CD8+ T cell, donor 702, replicate 1; Homo sapiens; RNA-Seq

single CD103- CD8+ T cell, donor 702, replicate 1

Cytotoxic T cells confer a prognostic benefit in many tumors, including ovarian cancer. We and others have previously identified a subset of CD8+ T cells, namely CD103+CD8+ T cells, that seems to have a better prognostic effect. The aim of this study is to identify how these CD103+ T cells differ from CD103-CD8+ T cells on mRNA level in human samples of ovarian cancer. Overall design: mRNA profiles of 10 pools of 20 cells CD103+CD8+, 10 pools of 20 cells CD103-CD8+, 20 single-cells CD103+CD8+, 20 single-cells CD103-CD8+ were generated from TILs of 3 ovarian cancers (high-grade serous ovarian cancer) by SMARTseq2

mRNA sequencing of single-cell and 20-cell pools of CD103+CD8+ and CD103-CD8+ T lymphocytes sorted from human ovarian cancer

Submitted by Gene Expression Omnibus on 07-MAR-2019

Ovarian tumors from two patients were cut into pieces of <1 mm3 and placed in a T75 culture flask (Nunc™ EasYFlask™ Cell Culture Flasks, cat. no. 156499, ThermoScientific) with digestion medium, consisting of RPMI (Gibco, Paisley, UK), 10% fetal bovine serum (FBS, Gibco, Paisley, UK), collagenase type IV (1 mg/mL; Gibco, Grand Island, USA), and 12.6 µg/mL recombinant human DNase (Pulmozyme,Roche, Woerden, the Netherlands) for overnight digestion at room temperature. After digestion, the suspension was strained through a 70 µm filter and washed with PBS. Cells were centrifuged over a Ficoll-Paque gradient (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) and lymphocytes were isolated from between the two layers. After a wash with PBS cells were pelleted. Total cell pellet was suspended in 1ml FBS with 10% dimethylsulfoxide (Merck, Darmstadt, Germany), and stored in liquid nitrogen until further use. Prior to sequencing, tumor digests were thawed on ice, washed with AIM-V medium (Gibco, Paisley, UK) with 5% pooled human serum (PHS, One Lambda, USA) and centrifuged at 1000 x g. The total cellpellets were resuspended in AIM-V with 5% PHS, and cells were incubated with CD3-BV421, CD4-PerCP-Cy5.5, CD8α-APCeFluor780, CD8β-PEcy7, TCRαβ-APC, CD103-FITC, and CD56-PE antibodies at 4°C for 45 minutes. After gating for CD3+CD4–CD8αβ+TCRαβ+CD56– cells, CD103– and CD103+ single cells were sorted on a Beckman Coulter Astrios cytometer directly into 4 µl lysis buffer (2 µl of 0.2% Triton X-100, Sigma-Aldrich, cat. no. T9284 with 5% recombinant RNase inhibitor (Westburg-Clontech, cat. no. 2313A), 1 µl 10µM barcoded oligo dT primer , and 1 µl 4x10mM dNTP mix)) in 96-well PCR plates. Each well contained a unique indexed Oligo dT primer enabling identification of individual cells after pooled RNA sequencing. In addition to single cell wells, small bulk populations of 20 cells were sorted per microplate well. Per patient, 40 single CD8+ T cells (20 wells CD103+, 20 wells CD103–) and 20 small bulk 20-cell populations (10 wells CD103+, 10 wells CD103–) were sorted. After sorting, the plate was vortexed and spin down briefly, and incubated at 72°C for 3 minutes. After this step the plate was kept cool. Custom primers were designed that include a PCR-primer recognition site for pre-PCR, a Unique Molecular Identifier (UMI), a cell barcode (see supplementary Table S4), and a poly T-stretch. Each cell (or pool) is tagged with an oligo dT primer, including the UMI and cell barcode. A template switching pre-PCR is used to generate cDNA. Pools are made of single cells or pools with unique cell barcodes and 500pg of the pools was tagmentated and barcoded using a N7xx index and custom P5 hybrid primer (AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C) according the Illumina Nextera XT DNA sample preparation kit protocol(Illumina, cat. no. FC-131-1096). The pools were purified using AMPure beads in a ratio of 0,6:1, to remove primer dimers. Presence and size distribution of the obtained PCR product were checked on a PerkinElmer LabChip GX high-sensitivity DNA chip. A super pool was created by equimolar pooling (1nmol/L) of the Nextera products, and the samples were sequenced on Illumina NextSeq500 2500 using 50 bp paired-end reads, one read for the mRNA transcript, and the other for the cell-barcode. The obtained RNA sequencing data were demultiplexed into individual FASTQ files.

A Transcriptionally Distinct CXCL13+CD103+CD8+ T-cell Population Is Associated with B-cell Recruitment and Neoantigen Load in Human Cancer.

mRNA sequencing of single-cell and 20-cell pools of CD103+CD8+ and CD103-CD8+ T lymphocytes sorted from human ovarian cancer

Submitter Supplied Information

Samples