Ion Torrent Proton sequencing; GSM2362698: PRO20150916_C1_1; Homo sapiens; RNA-Seq

PRO20150916_C1_1

5' selective RNA-seq of 96 single cells from human nasal epithelial cells. Cells grown for 33 days at an air liquid interface. RNAseq profiling  was performed with N4H4 unique molecular identifiers processed on a Fluidigm C1. Sequencing was performed on a Ion Proton (Life Technologies). Overall design: Single cell from human nasal epithelium. 5' selective RNAseq profiling, 96 cells, unique molecular identifiers, custom library preparation.

UMI-based, single cell RNA sequencing of human nasal epithelial cells grown for 33 days at air liquid interface

Submitted by Gene Expression Omnibus on 20-DEC-2016

HNEC cells were loaded onto a Fluidigm 96 cell IFC and lyzed with 0.2% w/v Tween 20, 1 U/ul Promega RNAsin RNAse inhibitor, 2 µM reverse transcription primer (TGCGGTATCTAAAGCGGTGAGT(30)VN), 2.5 mM dNTPs, 1x C1 loading reagent (Fluidigm), ERCC Spike-In Mix 1 @ 20,000 molecules/cell (Life Technologies). Cells were lyzed for 10 min at room temperature followed by 3 min at 70°C and 3 min at 10°C. Cells were processed in a 96 cell Fluidigm C1 IFC. Reverse transcription: 18 nl of 1.75 x  reverse transcription mix, 8.75 mM DTT, 1.75 M Betaine, 10.5 mM MgCl2, 1.75 uM template switching oligonucleotide (GCAATGAAGTCGCAGGGTTGN(4)H(4)rGrGrG), 0.5 U/ul Promega RNAsin, 5.5 U/ul Life Technologies Superscript II reverse transcriptase, 1x C1 loading reagent were added to each lysed cell and incubated for 10 min at 25°C, 90 min at 42°C, 15 min at 70°C. PCR amplification: 270 nl 1.15 x KAPAHiFi HotStart Ready Mix, 55 nM barcode primer (TGCGGTATCTAAAGCGGTGAGCCATCTCATCCCTGCGTGTCTCCGACTCAG<index>GCAATGAAGTCGCAGGGTTG, indices were standard ion torrent barcodes) and 1.1 µM biotinylated PCR primer were back-loaded to each cell. PCR amplification was for 3 min at 98°C followed by 18 cycles at 98°C for 20 sec, 64°C for 15 sec, 72°C for 6 min, and a final extension at 72°C for 5 min. Fragmentation and library preparation: Barcoded, amplified cDNA from all cells was pooled and fragmented by tagmentation with EzTn5 transposase (Epicentre) and Tn5 mosaic end duplexes (upper: 5’-AGA TGT GTA TAA GAG ACA-3’, lower: 5’-PhosCTG TCT CTT ATA CAC ATC T-3’), 5’ terminal (biotinylated) fragments were isolated with streptavidin beads and Ion Torrent adapter sequences were added by PCR (Primers: CCATCTCATCCCTGCGTGTCTC, 0.5 μM; CCACTACGCCTCCGCTTTCCTC, 0.5 μM; CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATAGATGTGTATAAGAGACAG,  0.125 μM). 5' selective, oligo-dT-primed RNA-seq based on the SmartSeq technique.

UMI-based, single cell RNA sequencing of human nasal epithelial cells grown for 33 days at air liquid interface

Submitter Supplied Information

Samples