Illumina HiSeq 2000 paired end sequencing; GSM2098545: scrbseq_2i; Mus musculus; RNA-Seq

scrbseq_2i

Gene expression heterogeneity in the pluripotent state of mouse embryonic stem cells (mESCs) has been increasingly well-characterized. In contrast, exit from pluripotency and lineage commitment have not been studied systematically at the single-cell level. Here we measured the gene expression dynamics of retinoic acid driven mESC differentiation using an unbiased single-cell transcriptomics approach. We found that the exit from pluripotency marks the start of a lineage bifurcation as well as a transient phase of susceptibility to lineage specifying signals. Our study revealed several transcriptional signatures of this phase, including a sharp increase of gene expression variability and a handover between two classes of transcription factors. In summary, we provide a comprehensive analysis of lineage commitment at the single cell level, a potential stepping stone to improved lineage control through timing of differentiation cues. Overall design: Bulk and single-cell RNA-seq (SCRB-seq and SMART-seq) of mouse embryonic stem cells after different periods of continuous exposure to retinoic acid. Bulk RNA-seq of cell lines derived after retinoic exposure and after differentiation with retinoic acid and MEK inhibitor combined.

Dynamics of lineage commitment revealed by single-cell transcriptomics of differentiating embryonic stem cells

Submitted by Gene Expression Omnibus on 24-OCT-2017

SCRB-seq: For each differentiation time point cells were harvested and medium removed by spinning for 5 min at 1000 rpm. RNA was stabilized by immediately resuspending the pelleted cells in RNAprotect Cell Reagent (Qiagen) and RNaseOUT Recombinant Ribonuclease Inhibitor (Life Technologies) at a 1:1000 dilution. Just prior to fluorescence-actived cell sorting (FACS), the cells were diluted in PBS and stained for viability using Hoechst 33342 (Life Technologies). 384-well SBS capture plates were filled with 5μl of a 1:500 dilution of Phusion HF buffer (New England Biolabs) in water and individual cells were then sorted into each well using a FACSAria II flow cytometer (BD Biosciences) based on Hoechst DNA staining. After sorting, the plates were immediately sealed, spun down, cooled on dry ice and then stored at -80°C. SMART-seq: The single-cell SMART-seq2 libraries were prepared according to the SMART-seq2 protocol with some modifications. Briefly, total RNA from single cells sorted in lysis buffer was purified using RNA-SPRI beads. Bulk RNA-seq: Populations of sorted cells were collected in RNAprotect, lysed in QIAzol (Qiagen) and total RNA was extracted and purified using Direct-zol RNA MiniPrep (Zymo Research). SCRB-seq: Frozen cells were thawed for 5 minutes at room temperature and cell lysis was enhanced by a treatment with proteinase K (200 μg/mL;Ambion) followed by RNA desiccation to inactivate the proteinase K and simultaneously reduce the reaction volume (50 °C for 15 min in sealed plate, then 95 °C for 10 min with seal removed ).   To start, diluted ERCC RNA Spike-In Mix (1 μl of 1:10^7; Life Technologies) was added to each well and the template switching reverse transcription reaction was carried out using Maxima H Minus Reverse Transcriptase (Thermo Scientific), our universal adapter E5V6NEXT (1 pmol, Eurogentec): 5’-iCiGiCACACTCTTTCCCTACACGACGCrGrGrG-3’ where iC: iso-dC, iG: iso-dG, rG: RNA G, and our barcoded adapter E3V6NEXT (1 pmol, Integrated DNA Technologies):5'/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN-3' where 5Biosg = 5’ biotin, [BC6] = 6bp barcode specific to each cell/well, N10 = Unique Molecular Identifiers. Following the template switching reaction, cDNA from 384 wells was pooled together, and then purified and concentrated using a single DNA Clean & Concentrator-5 column (Zymo Research). Pooled cDNAs were treated with Exonuclease I (New England Biolabs) and then amplified by single primer PCR using the Advantage 2 Polymerase Mix (Clontech) and our SINGV6 primer (10 pmol, Integrated DNA Technologies): 5’-/5Biosg/ACACTCTTTCCCTACACGACGC-3’ Full length cDNAs were purified with Agencourt AMPure XP magnetic beads (0.6x, Beckman Coulter) and quantified on the Qubit 2.0 Flurometer using the dsDNA HS Assay (Life Technologies). Full-length cDNA was then used as input to the Nextera XT library preparation kit (Illumina) according to the manufacturer’s protocol, with the exception that the i5 primer was replaced by our P5NEXTPT5 primer (5μM, Integrated DNA Technologies): 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T*-3’ where * = phosphorothioate bonds. The resulting sequencing library was purified with Agencourt AMPure XP magnetic beads (0.6x, Beckman Coulter), size selected (300-800bp) on a E-Gel EX Gel, 2% (Life Technologies), purified using the QIAquick Gel Extraction Kit (Qiagen) and quantified on the Qubit 2.0 Flurometer using the dsDNA HS Assay (Life Technologies). Libraries were sequenced on Illumina Hiseq paired-end flow cells with 17 cycles on the first read to decode the well barcode and UMI, an 9 cycle index read to decode the i7 Nextera barcode and finally a 46 cycle second read to sequence the cDNA. SMART-seq: The single-cell SMART-seq2 libraries were prepared according to the SMART-seq2 protocol with some modifications 29. Briefly, total RNA from single cells sorted in lysis buffer was purified using RNA-SPRI beads. Poly(A)+ mRNA from each single cell was converted to cDNA which was then amplified. cDNA was subjected to transposon-based fragmentation that used dual-indexing to barcode each fragment of each converted transcript with a combination of barcodes specific to each single cell. Barcoded cDNA fragments were then pooled prior to sequencing. Sequencing was carried out as paired-end 2x25bp with 8 additional cycles for each index. Bulk RNA-seq: DGE libraries were prepared from 10 ng of extracted total RNA, using the protocol previously described for SCRB-seq with the exception of using more concentrated E3V6NEXT and E5V6NEXT (10 pmol).  SCRB-seq: Frozen cells were thawed for 5 minutes at room temperature and cell lysis was enhanced by a treatment with proteinase K (200 μg/mL;Ambion) followed by RNA desiccation to inactivate the proteinase K and simultaneously reduce the reaction volume (50 °C for 15 min in sealed plate, then 95 °C for 10 min with seal removed ).   To start, diluted ERCC RNA Spike-In Mix (1 μl of 1:107; Life Technologies) was added to each well and the template switching reverse transcription reaction was carried out using Maxima H Minus Reverse Transcriptase (Thermo Scientific), our universal adapter E5V6NEXT (1 pmol, Eurogentec):  5’-iCiGiCACACTCTTTCCCTACACGACGCrGrGrG-3’  where iC: iso-dC, iG: iso-dG, rG: RNA G, and our barcoded adapter E3V6NEXT (1 pmol, Integrated DNA Technologies):  5'-/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN-3'  where 5Biosg = 5’ biotin, [BC6] = 6bp barcode specific to each cell/well, N10 = Unique Molecular Identifiers. Following the template switching reaction, cDNA from 384 wells was pooled together, and then purified and concentrated using a single DNA Clean & Concentrator-5 column (Zymo Research). Pooled cDNAs were treated with Exonuclease I (New England Biolabs) and then amplified by single primer PCR using the Advantage 2 Polymerase Mix (Clontech) and our SINGV6 primer (10 pmol, Integrated DNA Technologies):  5’-/5Biosg/ACACTCTTTCCCTACACGACGC-3’  Full length cDNAs were purified with Agencourt AMPure XP magnetic beads (0.6x, Beckman Coulter) and quantified on the Qubit 2.0 Flurometer using the dsDNA HS Assay (Life Technologies). Full-length cDNA was then used as input to the Nextera XT library preparation kit (Illumina) according to the manufacturer’s protocol, with the exception that the i5 primer was replaced by our P5NEXTPT5 primer (5μM, Integrated DNA Technologies):  5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T*-3’  where * = phosphorothioate bonds.  The resulting sequencing library was purified with Agencourt AMPure XP magnetic beads (0.6x, Beckman Coulter), size selected (300-800bp) on a E-Gel EX Gel, 2% (Life Technologies), purified using the QIAquick Gel Extraction Kit (Qiagen) and quantified on the Qubit 2.0 Flurometer using the dsDNA HS Assay (Life Technologies). Libraries were sequenced on Illumina Hiseq paired-end flow cells with 17 cycles on the first read to decode the well barcode and UMI, an 9 cycle index read to decode the i7 Nextera barcode and finally a 46 cycle second read to sequence the cDNA.

Dynamics of lineage commitment revealed by single-cell transcriptomics of differentiating embryonic stem cells

Submitter Supplied Information

Samples