All strains were grown by inoculating 5 mL YPAD cultures with the indicated frozen yeast strains or freshly streaked colonies, and incubating at 30°C and 180 rpm. After ~ 24 hours, 25 mL YPAD cultures were seeded at A660 ~0.0002 and grown at 30°C and 180 rpm until A660 0.5-0.8. Yeast were harvested by centrifugation for 10 minutes at 3,000 rpm at 4°C, and the pellets were washed once with 40 mL of ice-cold water. Cells were resuspended in 500 µL RNA ISO Buffer (0.2M Tris-HCl pH 7.5, 0.5M NaCl, 0.01M EDTA, 1% SDS). Then, ~200 µL of acid washed beads and 500 µL of Phenol:Chloroform:Isoamyl alcohol (25:24:1) (PCA) were added. Cells were lysed by vortexing for 20 sec followed by 20 sec on ice ten times. Samples were then separated from the beads, split evenly into two tubes, and 375 µL of RNA ISO Buffer and 375 µL of PCA were added to each tube. Samples were mixed by gently shaking and were separated by centrifugation for 15 minutes at 15,000 rpm at 4°C. The aqueous layer was removed (~500 µL) and further extracted by two additional extractions (PCA followed by chloroform). Following the extractions, the aqueous layer was removed and ~1 mL of 100% ethanol was added to the samples, which were gently mixed and incubated at -50°C for > 1 hour. Total RNA was pelleted by centrifugation for 30 minutes at 15,000 rpm at 4°C. Pellets were washed 1X with ~70% ethanol, and resuspended in 43 µL of water. Separate tubes for each sample were then recombined, and treated with 8 Units of TURBO DNase (Life Technologies) for 1 hour at 37°C. Total RNA was purified using the GeneJet RNA Purification kit (Thermo Fisher Scientific) and eluted in 30 µL of water. RNA samples were stored at -80°C.    Poly(A) selection and rRNA depletion: Approximately 75 µg of high-quality total RNA were poly(A) selected using the Dynabeads mRNA Purification kit (Life Technologies) and the standard protocol. Samples were eluted in 28 µL of water. The poly(A)-selected RNA was then depleted of rRNA using the RiboZeroGold (yeast) kit (Epicentre) and the standard protocol. Samples were eluted in 12 µL of water.    G/I-tailing: Samples were G/I-tailed as above, except for the following step. After the initial 90 minute G/I-tailing reaction, an additional 1,200 Units of yeast PAP was added to the reactions and incubated for an additional 30 minutes at 37°C. G/I-tailed RNA was purified as above using PCA.     Selective reverse transcription and RNase H digestion: G/I-tailed samples were selectively reverse transcribed as above. cDNAs were digested with 1 µL of RNaseH (Invitrogen) for 20 minutes at 37°C. cDNAs were purified using the GeneJet PCR Purification kit (Thermo Fisher Scientific). cDNAs were eluted twice in 32 µL of water giving a total of ~60 µL cDNA.    Second strand synthesis: 60 µL of cDNA was added to 10 µL of 10X Klenow Buffer (500 mM Tris-HCl pH 7.5, 100 mM MgCL2, 10 mM DTT, 0.5 mg/mL BSA), 12 µL of water, 5 µL of 10 mM dNTPs, 10 µL of 10 µM 2nd strand synthesis primer (GTTCAGAGTTCTACAGTCCGACGATCNNNNNN), and 3 µL of 5 U/µL Exo- Klenow DNA Polymerase (Life Technologies). Reactions were incubated at 37°C for 30 minutes, and then purified twice using RNA Clean XP beads (Agencourt) at a 1:1 (bead:reaction) ratio. dsDNA was eluted in 50 µL of water.    Polymerase chain reactions: Samples were PCR amplified using GoTaq polymerase (Promega). 5 µL of cDNA was added to 8.33 µL of 2X GoTaqGreen master mix, 2 µL of water, 0.67 µL of 10 µM RP1 primer (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA), and 0.67 µL of 10 µM barcoded primer (CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA). Standard Illumina barcodes were inserted at the XXXXXX position in the primer. The PCR cycle was: 1) 94°C for 2 min, 2) 94°C for 10 sec, 3) 40°C for 2 min, 4) 72°C for 1 min, 5) Repeat 2-4 once, 6) 94°C for 10 sec, 7) 55°C for 30 sec 8) 72°C for 1 min, 9) Repeat 6-8 7X, 10) 94°C for 15 sec, 11) 55°C for 30 sec, 12) 72°C for 1 min, 13) Repeat 10-12 14 times, 14) 72°C for 5 min, 15) Hold at 4°C. To scale up, ~9 individual reactions were completed for each sample and were pooled prior to cleanup. PCR samples were size-selected twice using the RNA Clean XP beads at a 0.8:1 (bead:reaction) ratio. Samples were eluted in ~ 20 µL of water.

RNA Tagging in yeast

Submitter Supplied Information

Samples